Haplogroup Q-M242

Source: Wikipedia, the free encyclopedia.
Haplogroup Q
tribes of Assam

Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.

Q-M242 is the predominant

Y-DNA haplogroup among Native Americans and several peoples of Central Asia and Northern Siberia
.

Origins

Haplogroup Q-M242 is one of the two branches of P-P226 (M45), the other being R-M207.[15]

Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia),[3] approximately 17,000[3] to 31,700 years ago.[4] However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.

Technical specification of mutation

The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003.[16] The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The 2015 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree[5] are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • Q-M242 M242

The Genomic Research Center draft tree

Below is a 2012 tree by Thomas Krahn of the Genomic Research Center.[17] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[18]

  • P-M45
    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1

The Y Chromosome Consortium tree

This is the 2008 tree produced by the Y Chromosome Consortium (YCC).[19] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[20] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

Phylogenetic variants

The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2.[21] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.[6]

Distribution

Americas

Several branches of haplogroup Q-M242 have been predominant

from Asia into the Americas by crossing the Bering Strait.[3] These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01
. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.

North America

In the indigenous people of North America, Q-M242 is found in

Aleut populations. (Q-M3 occupies 46% among Q in North America)[23]

On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans.[24] Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.[13]

Q-M242 is estimated to occupy 3.1% of the whole US population in 2010:[25]

Ethnicity Percentage of USA population † Haplogroup Q frequency
White people 63.7% Q-P36* 0.6% & Q-M3 0.1%
Hispanic 16.3% Q-P36* 3.8% & Q-M3 7.9%
Black 12.6% Q-P36* (xM3) 0.2%
Asian 4.8% ~0%
Native American ‡ 0.9% Q-P36* 31.2% & Q-M3 26.9%
Source :[25]

† According to the US National Population

Census data (2010)[26]

‡ Mainland and Alaska, not including the Pacific islands

Mesoamerica & South America

Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.[8]

The frequencies of Q among the whole male population of each country reach as follows:

Asia

Q-M242 originated in

, and so on. (For details, see below.)

North Asia

In

Tubalars
at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern
Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples.[11] In another study,[52] the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%[53]~38.0% (41/108)[52] of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva show the frequency at ≤22.2% (8/36 P(xR1)[54])~38.5% (10/26, all Q-M346(xM3)).[52] So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern Xinjiang near the international border with Altai Republic.[12]

In Siberian Tatars, the Ishtyako-Tokuz sub-group of Tobol-Irtysh group has a frequency of Q-M242 at 38%.[14]

The highest frequencies of Q-M242 in Eurasia are witnessed in

Na-Dené languages[55] and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank,[56] E. Vajda,[57] A. Vovin,[58]
etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), and so on.

In far eastern Siberia, Q-M242 is found in 35.3% of

Kolyma River, which is located northwest of Kamchatka.[41] It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.[29]

East Asia

In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4[29]~3.1%[50] of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25[29]~1.25%[50]), Q1a1b-M25 (0.25[29]~0.63%[50]), Q1b-M378. In another study, Q is found in 4% of Mongols.[8] Karafet et al. (2018) found Q-L54(xM3) in 2.7% (2/75) and Q-M25 in another 2.7% (2/75) for a total of 5.3% (4/75) haplogroup Q Y-DNA in a sample of Khalkha Mongols from Ulaanbaatar, Mongolia.[60] Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.

However, most of Q-M242 people in

northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China.[43][44] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.[61] In another study published in 2011, Hua Zhong et al. found haplogroup Q-M242 in 3.99% (34/853, including 30/853 Q-M120, 3/853 Q-M346, and 1/853 Q-M25) of a pool of samples of Han Chinese from northern China and 1.71% (15/876, including 14/876 Q-M120 and 1/876 Q-M346) of a pool of samples of Han Chinese from southern China.[62] Q1a1-M120 is unique to East Asians. It is not found in South east Asia except with low diversity in Y-STR among southern Han Chinese indicating it spread during the Neolithic with Han Chinese culture to southern China from northern China. Q1a3*-M346 is only found among Hui and southern Han Chinese in South East Asia in southern China but not found in non-Han indigenous peoples at all. It came from northern China (north east Asia) with the Han. Only Native Americans have Q1a3a-M3, which is a descendant haplogroup of Q1a3*-M346. The Americas was populated by migrants from Central Asia in prehistoric times.[63] Q1a1 is attested in over 3,000 year old Han Chinese ancestral remains in the Shang and Zhou dynasties from the Hengbei archeological site.[64] Modern northern Han Chinese Y haplogroups and mtdna match those of ancient northern Han Chinese ancestors 3,000 years ago from the Hengbei archeological site. 89 ancient samples were taken. Y haplogroups O3a, O3a3, M, O2a, Q1a1, and O* were all found in Hengbei samples.[65]

Q-M242 has been found with notable frequency in some samples of

Uyghurs: 15.38% (22/143, including 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) of a sample of Uyghurs from the Turpan area (吐鲁番地区),[66] 7.9% (6/76, including 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) of a sample of Dolan Uyghurs (刀郎人) from Horiqol Township of Awat County,[67] and 7.74% (37/478, including 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) of a sample of Uyghurs from the Hotan area (和田地区).[68] However, other studies have found haplogroup Q in much smaller percentages of Uyghur samples: 3.0% (2/67) Q-P36 Uygur,[69] 1.6% (1/64) Q-M120 Lop Uyghur (罗布人).[67] Haplogroup Q was not observed in a sample of 39 Keriyan Uyghurs (克里雅人) from the village of Darya Boyi, located on the Keriya River deep in the Taklamakan Desert.[67]

Haplogroup Q was observed in 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet in one study[45] and in 1.23% (29/2354) of males in Tibet in another study,[70] but this haplogroup was not observed in a sample of males from Tibet (n=105) in a third study.[69]

It is found in about 1.9% of South Koreans,[71][72][73] showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It has been found in about 0.3% of Japanese[74][69][75][76][77] (with known examples from Shizuoka[69] and Saitama[76]) and in 0.3%[48]~1.2%[78] of Taiwanese.

Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.[79]

Southeast Asia

Haplogroup Q shows low frequencies in Southeast Asia. In a study,[46] the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries.[48]

In the case of

Red River Delta region, and 42 of whom are from Hanoi) and found that two of them (4%) belong to Q-M120.[82]

Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in 18.8% in Ayeyarwady (2/11) and 7.1% Bago (1/14) regions in southwest Myanmar.[83] And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand.[48]

Central Asia

In Central Asia, the southern regions show higher frequencies of Q than the northern ones.

In the northern regions, Q-M242 is found in about 2%

Kankalis and probably also the Kangar union. Haplogroup Q is found in about 2% of Kyrgyz people.[50][85][86]

In the southern regions, Q-M242 is found in 5%

Jawzjan, Afghanistan, so the frequency of Q-M242 may reach about 40% in Turkmens of Afghanistan and Iran
who live in the areas adjacent to Turkmenistan.

Q-M242 accounts for 6.9% of

Afghans in a study (Haber 2012). In another study (Cristofaro 2013) with a larger sampling, the frequency of Q rises to 8.9% (45/507). Haplogroup Q occurs at a frequency of 8% (11/136) in Afghan Pashtuns and 3% (5/142) in Afghan Tajiks.[90][91] In this study(Cristofaro 2013), Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[50]

Southwest Asia

Southwest Asia exhibits high frequencies of Q in northern Iran
, and gradually lowering ones to the southwest.

Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in

Fars (Persian people), and so on.[92] Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[93][94][95]

In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.[96]

Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.[97][98]

Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36)

Syrians[80] and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.[99]

Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q.[100] In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[101]

South Asia

In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[102]~3.4% (6/176).[103]

In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples.[6] (For more information, see Y-DNA haplogroups in populations of South Asia)

In a regional study in Gujarat (Western India), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284).[104] In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in New Delhi, the capital of India were found to be Q-M242 positive.[105]

In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh.[106] In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.

1.2% of

Nepalese people in Kathmandu, the capital of Nepal and 3.2% of people from Tibet are in Q-M242.[45]

3.3% of Sri Lankans[80] are also in Q-M242.

Europe

Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

Central- and Eastern Europe

In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians,[107] 1.5% of Belarusians,[108] 1.3% of Ukrainians[citation needed] 1.3% of Poles (Poland),[109] 2% of Czechs,[110] 1.5% of Slovaks,[111] about 2.2% of Hungarians,{citation needed} 1.2% of Romanians,[112] 0.8% of Moldovans,[113] and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians[114] On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila's Huns) turned out to be P* (xR1-M173),[115] which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.[116][117]

The Caucasus region shows a frequency at 1.2% in a study,[94] but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242.[93] It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.[118]

Northern Europe

In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

In Norway, Q-M242 is found in about 2.6% (~4%[119]) of males, with Q-L804 being more common than Q-F1161/L527.[120] It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings).[121] In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242.[119][122] On the other hand, it is 0.2% in Finland,[123] 4.6% in Latvia,[124] 1.1% in Lithuania,[125] 0.5% in Estonia.

Western Europe

In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland,[126] and it reaches 5.1% in Lyon (Rhône-Alpes) region of France.[127] It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia. Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).[119]

Southern Europe

Ragusa, 3.6% in Sciacca,[128] and 3.7% in Belvedere Marittimo.[129]

On the other hand, according to a study (Behar 2004), 5.2% (23/441) of

Sephardi Jews
are in haplogroup Q.

Africa

Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147),[98] of Egyptians and in 0.6% (1/156)[94] of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

Subclade distribution

Y-DNA Q samples from ancient sites

  • South Central Siberia (near Altai)
    • Afontova-Gora-2,
      Yenisei River Bank, Krasnoyarsk (South Central Siberia of Russia), 17000YBP: Q1a1-F1215 (mtDNA R)[147]
  • North America
  • Altai (West Mongolia)
    • Tsagaan Asga and Takhilgat Uzuur-5 Kurgan sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)[151]
  • Greenland
  • China
    • Hengbei site (Peng kingdom cemetery of Western Zhou period), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[153]
      • In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*[154]
      • (cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
    • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120[153] (with a lot of animal bones and bronze swords and other weapons, etc.)
    • Heigouliang, Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):[155]
      • In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at
        Hami
        . The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.
    • Xiongnu site in Barkol, Xinjiang, all 3 Q-M3
      • In L. L. Kang et al. (2013), three samples from a Xiongnu) site in
        Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the Yeniseian languages.[156][157] These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the Huns
        .
    • Mongolian noble burials in the Yuan dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)[158]
      • (cf) Korguz was a son of a princess of Kublai Khan (元 世祖), and was the king of the Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor, Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the Shatuo tribe (沙陀族) which was a tribe of Göktürks (Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of the Yuan dynasty married kings of the Ongud tribe.

See also

Populations

Y-DNA Q-M242 subclades

Y-DNA backbone tree

References

  1. PMID 28251872
    .
  2. . Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  3. ^ .
  4. ^ a b YFull YTree v4.02
  5. ^ a b Y-DNA Haplogroup Q and its Subclades - 2016
  6. ^
    PMID 18021436
    .
  7. ^ .
  8. ^ .
  9. ^ Zegura Stephen L., Tatiana M. Karafet, Lev A. Zhivotovsky, Michael F. Hammer. High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, 2004.
  10. ^ https://www.researchgate.net/publication/310645015_Gene_pool_of_Turkmens_from_Karakalpakstan_in_their_Central_Asian_context_Y-chromosome_polymorphism[full citation needed]
  11. ^
    S2CID 566825
    .
  12. ^ .
  13. ^ .
  14. ^ a b Пять генофондов пяти субэтносов сибирских татар
  15. ^ Estes, Roberta (2020-09-12). "Y DNA Haplogroup P Gets a Brand-New Root – Plus Some Branches". DNAeXplained - Genetic Genealogy. Retrieved 2024-01-21.
  16. PMID 12929085
    .
  17. ^ Proposed Tree Archived 2011-07-11 at the Wayback Machine
  18. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Archived from the original on 2015-08-15.
  19. PMID 18385274
    .
  20. ^ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  21. STR DYS435
    with a value of 8→9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
  22. .
  23. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Archived from the original on 2009-11-04. Retrieved 2010-01-30.
  24. ^
    PMID 20148029
    .
  25. ^ .
  26. ^ Population Estimates Archived 2014-12-18 at the Wayback Machine
  27. S2CID 2906322
    .
  28. . => Guatemala population consists of about 40% Tribal Natives (Mayans)+60% Native (Spanish Speaking). According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%
  29. ^ .
  30. .
  31. .
  32. .
  33. .
  34. .=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestry, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
  35. . The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
  36. .
  37. .
  38. .
  39. PMID 22808085.=> about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of Brazil
    can be classified as Y-DNA Q.
  40. ^ . The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
  41. ^ .
  42. ^ .
  43. ^
  44. ^ .
  45. ^ .
  46. ^ .
  47. ^ .
  48. ^ .
  49. ^ a b c "The Y Chromosome Consortium 2008". Archived from the original on 2008-09-22. Retrieved 2010-07-17.
  50. ^
    PMID 24204668
    .
  51. .
  52. ^ .
  53. ^ KHARKOV, Vladimir Nikolaevich, "СТРУКТУРА И ФИЛОГЕОГРАФИЯ ГЕНОФОНДА КОРЕННОГО НАСЕЛЕНИЯ СИБИРИ ПО МАРКЕРАМ Y-ХРОМОСОМЫ," Genetika 03.02.07 and "АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора биологических наук," Tomsk 2012
  54. S2CID 23011845
    .
  55. ^ E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology
  56. ^ E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2
  57. ^ E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.
  58. ^ "Did the Xiong-nu speak a Yeniseian language?". Central Asiatic Journal. 44 (1): 87–104. 2000.
  59. PMID 19259129
    .
  60. .
  61. .
  62. .
  63. from the original on 2020-05-07.
  64. .
  65. .
  66. ^ Lu Yan (2011), "Genetic Mixture of Populations in Western China." Shanghai: Fudan University, 2011: 1-84. (Doctoral dissertation in Chinese: 陆艳, “中国西部人群的遗传混合”, 上海:复旦大学,2011: 1-84.)
  67. ^ .
  68. .
  69. ^ .
  70. .
  71. .
  72. .
  73. ^ The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.
  74. ^ Peter A. Underhill, Peidong Shen, Alice A. Lin, et al. (2000), "Y chromosome sequence variation and the history of human populations." Nature Genetics, Volume 26, November 2000.
  75. PMID 16489223
    .
  76. ^ .
  77. ^ .
  78. ^ .
  79. .
  80. ^ .
  81. ^ .
  82. ^ a b Enrico Macholdt, Leonardo Arias, Nguyen Thuy Duong, et al., "The paternal and maternal genetic history of Vietnamese populations." European Journal of Human Genetics (2020) 28:636–645. https://doi.org/10.1038/s41431-019-0557-4
  83. PMID 24281365
    .
  84. ^ Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs". The Russian Journal of Genetic Genealogy. 2: 1.
  85. ^
    PMID 11526236
    .
  86. ^ .
  87. ^ E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.
  88. S2CID 2752490
    .
  89. .
  90. .
  91. .
  92. ^ .
  93. ^ .
  94. ^ .
  95. ^ The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.
  96. PMID 21970613
    .
  97. ^ .
  98. ^ .
  99. .
  100. ^ .
  101. . Retrieved May 13, 2014.
  102. .
  103. ^ .
  104. .
  105. .
  106. .
  107. .
  108. .
  109. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  110. PMID 21674832
    .
  111. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  112. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  113. PMID 23341985
    .
  114. .
  115. .
  116. ^ Hungarian Bukovina
  117. ^ Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789
  118. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  119. ^ a b c David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf
  120. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  121. ^ Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
  122. ^ Shetland Islands Haplogroups R1a & Q
  123. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  124. ^ "Family Tree DNA - My FamilyTree DNA Latvia Project Website".
  125. ^ "Family Tree DNA - LITHUANIAN DNA".
  126. ^ "Family Tree DNA - Switzerland DNA Project".
  127. ^ a b Wiik, Kalevi (2008). "Where did European Men Come From?". Journal of Genetic Genealogy. 4: 35–85.
  128. PMID 18685561
    .
  129. . In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).
  130. .
  131. .
  132. ^ Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10
  133. PMID 22470552
    .
  134. .
  135. .
  136. .
  137. .
  138. ^ .
  139. .
  140. .
  141. ^ Monika Karmin, Lauri Saag, Mário Vicente, et al. (2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." Genome Research 25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.
  142. PMID 18374297
    .
  143. ^ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Archived from the original on 2010-06-22. Retrieved 2009-11-21.
  144. S2CID 1571356
    . Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  145. .
  146. ^ Brook, Kevin Alan (2018). The Jews of Khazaria (3rd ed.), p. 204. Rowman & Littlefield.
  147. ^ YFull - Experimental Y Tree, Y-SNP calls for Afontova Gora 2, Afantova had haplogroup Q1a1 and some type of R derived mtdna.
  148. PMID 24522598
    .
  149. .
  150. .
  151. ^ Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
  152. ^ "Q-YP1500 YTree".
  153. ^ a b On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  154. S2CID 20553478
    .
  155. ^ Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  156. ^ L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)
  157. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  158. PMID 25487330
    .

Bibliography

External links